Answered

Welcome to Westonci.ca, the Q&A platform where your questions are met with detailed answers from experienced experts. Discover a wealth of knowledge from professionals across various disciplines on our user-friendly Q&A platform. Explore comprehensive solutions to your questions from a wide range of professionals on our user-friendly platform.

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

A Segment Of DNA Is Known To Contain The Following Base Sequence3 GATACCTTTGTGTAGTCATCTT 5a Write The MRNA That Would Be Transcribed From This DNA Fragmentb Cir class=

Sagot :

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

Thank you for your visit. We're committed to providing you with the best information available. Return anytime for more. Thanks for using our service. We're always here to provide accurate and up-to-date answers to all your queries. Get the answers you need at Westonci.ca. Stay informed by returning for our latest expert advice.