Answered

Westonci.ca makes finding answers easy, with a community of experts ready to provide you with the information you seek. Get quick and reliable solutions to your questions from a community of experienced experts on our platform. Discover in-depth answers to your questions from a wide network of professionals on our user-friendly Q&A platform.

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Sagot :

luisvaschetto

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

We hope this was helpful. Please come back whenever you need more information or answers to your queries. Thank you for your visit. We're committed to providing you with the best information available. Return anytime for more. We're here to help at Westonci.ca. Keep visiting for the best answers to your questions.