Answered

Discover the answers to your questions at Westonci.ca, where experts share their knowledge and insights with you. Discover a wealth of knowledge from professionals across various disciplines on our user-friendly Q&A platform. Our platform offers a seamless experience for finding reliable answers from a network of knowledgeable professionals.

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Sagot :

mhernandez92182

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

shivjimishraVT

Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

What do you mean by Transcription?

Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).

Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.

Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

To learn more about Transcription, refer to the link:

https://brainly.com/question/1048150

#SPJ4

Thank you for visiting. Our goal is to provide the most accurate answers for all your informational needs. Come back soon. Thanks for using our service. We're always here to provide accurate and up-to-date answers to all your queries. Find reliable answers at Westonci.ca. Visit us again for the latest updates and expert advice.