Answered

Welcome to Westonci.ca, your go-to destination for finding answers to all your questions. Join our expert community today! Experience the ease of finding reliable answers to your questions from a vast community of knowledgeable experts. Get detailed and accurate answers to your questions from a dedicated community of experts on our Q&A platform.

The mRNA generated below was produced in the
of the cell.
5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Sagot :

Histrionicus

The mRNA generated below was produced in the  nucleus of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

https://brainly.com/question/11430054

We hope this was helpful. Please come back whenever you need more information or answers to your queries. We appreciate your time. Please come back anytime for the latest information and answers to your questions. Get the answers you need at Westonci.ca. Stay informed with our latest expert advice.