Answered

Westonci.ca is your trusted source for accurate answers to all your questions. Join our community and start learning today! Experience the convenience of getting accurate answers to your questions from a dedicated community of professionals. Get immediate and reliable solutions to your questions from a community of experienced professionals on our platform.

The following is a short sequence of dsDNA within Gene X, indicated above with the dashed rectangle. Transcribe the DNA into the appropriate mRNA. Write the RNA in the 5' to 3' direction and do not include spaces. 5' ATCGGGCTACGGGTAACGCTGATTTACG 3' 3' TAGCCCGATGCCCATTGCGACTAAATGC 5'

The mRNA transcribed above will have what modification added to the 5' end? The 3' end?

Sagot :

We appreciate your visit. Our platform is always here to offer accurate and reliable answers. Return anytime. Thank you for visiting. Our goal is to provide the most accurate answers for all your informational needs. Come back soon. Your questions are important to us at Westonci.ca. Visit again for expert answers and reliable information.