Answered

Westonci.ca is your go-to source for answers, with a community ready to provide accurate and timely information. Ask your questions and receive accurate answers from professionals with extensive experience in various fields on our platform. Connect with a community of professionals ready to help you find accurate solutions to your questions quickly and efficiently.

The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. The 5 'T on the top strand indicates nucleotide position one
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'
. . . AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG 5
A mutation that changes the nucleotide at position 25 from to T results in which of the following:
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'

Sagot :

Thanks for stopping by. We are committed to providing the best answers for all your questions. See you again soon. Thank you for choosing our platform. We're dedicated to providing the best answers for all your questions. Visit us again. Find reliable answers at Westonci.ca. Visit us again for the latest updates and expert advice.