Answered

Get reliable answers to your questions at Westonci.ca, where our knowledgeable community is always ready to help. Join our Q&A platform and connect with professionals ready to provide precise answers to your questions in various areas. Join our Q&A platform to connect with experts dedicated to providing accurate answers to your questions in various fields.

The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. The 5 'T on the top strand indicates nucleotide position one.
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'
. . . AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG 5
A mutation that changes the nucleotide at position 25 from to T results in which of the following:
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'

Sagot :

Visit us again for up-to-date and reliable answers. We're always ready to assist you with your informational needs. Thanks for stopping by. We strive to provide the best answers for all your questions. See you again soon. Get the answers you need at Westonci.ca. Stay informed with our latest expert advice.